Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06251

HP ID(1) HP06251
Gene ID(2) 51095
Gene Symbol finder TRNT1
Protein Name tRNA nucleotidyl transferase, CCA-adding, 1
RefSeq NM_182916.2
Length of RefSeq (bp) 2291
Chromosome 3p25.1
Reference DDBJ accession
UniGene Hs.567495

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb55A03 pGCAP1 GGGGCGCGCGCCGCTCAGAGGGGCAGAGTTGGTGGCGTGAGTTGCTGCCCCTTCCTTCCT
RBdS014L20 pGCAP10 GGGTGACGTCACCGCGTTCACCAGCCCGGAAGTGCGCGTGGCGGCGGTGGCGGCTGCGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl