Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06234

HP ID(1) HP06234
Gene ID(2) 84108
Gene Symbol finder PCGF6
Protein Name polycomb group ring finger 6
RefSeq NM_001011663.1
Length of RefSeq (bp) 2248
Chromosome 10q24.33
Reference DDBJ accession
UniGene Hs.719328

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb49H06 pGCAP1 GGCTCTCCCGCCGCCTCGCCTCGCCTGGTGTCTCTCCCGACCATGGTAGGGGGTCGCGGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl