Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06226

HP ID(1) HP06226
Gene ID(2)
Gene Symbol finder TBC1D22A(upstream, opposite)
Protein Name Transcribed locus
RefSeq
Length of RefSeq (bp) 658
Chromosome 22q13.31
Reference DDBJ accession CR613972.1
UniGene Hs.658853

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb48E03 pGCAP1 GACACGCCATCGCGGANGGGAGCGGAGGTGGTTGGGTTTCTGAGTTTGAGTCTGTCGCTC
RBdS075M03 pGCAP10 TGACACGCATCGCGGAGGGAGCGGAGGTGGTTGGGTTTCTGAGTTTGAGTCTGTCGCTCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl