Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06208

HP ID(1) HP06208
Gene ID(2) 3196
Gene Symbol finder TLX2
Protein Name T-cell leukemia homeobox 2
RefSeq NM_016170.3
Length of RefSeq (bp) 1771
Chromosome 2p13.1
Reference DDBJ accession
UniGene Hs.168586

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb39B10 pGCAP1 AB593086 GGTAAAATGTTTATGGGAAACAAGGCGGCCAGGATCCAACCAAGGCCTCAGTGAGGTCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl