Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06197

HP ID(1) HP06197
Gene ID(2) 10248
Gene Symbol finder POP7
Protein Name processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae)
RefSeq NM_005837.2
Length of RefSeq (bp) 949
Chromosome 7q22
Reference DDBJ accession
UniGene Hs.416994

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi53B06 pGCAP10 GGGGAAGGCGATTCATAGCTCGCGGGGTACGGGCGCGCGTGCGCACTCCGCAGCCCGTTC
ARiS194C20 pGCAP10 GCAGGACCCCGGCGCGGGCAGGGCGCCCACGAGCTGGCTGGCTGCTTGCACCCACATCCT
RBb43F08 pGCAP1 GACTCCGCAGCCCGTTCAGGACCCCGGCGCGGGCAGGGCGCCCACGAGCTGGCTGGCTGC
RBd94C05 pGCAP10 GGGCGCGGGCAGGGCGCCCACGAGCTGGCTGGCTGCTTGCACCCACATCCTTCTTTCTCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl