Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06184

HP ID(1) HP06184
Gene ID(2) 7398
Gene Symbol finder USP1
Protein Name ubiquitin specific peptidase 1
RefSeq NM_003368.4
Length of RefSeq (bp) 3949
Chromosome 1p31.3
Reference DDBJ accession
UniGene Hs.35086

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb41E10 pGCAP1 GTCCCTCAACTCGCGCGCACGAATGGTTAAAAAAAGGGTGTGAGGCTCGAGCCCGCCAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl