Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06138

HP ID(1) HP06138
Gene ID(2) 79664
Gene Symbol finder NARG2
Protein Name NMDA receptor regulated 2
RefSeq NM_024611.4
Length of RefSeq (bp) 7209
Chromosome 15q22.2
Reference DDBJ accession
UniGene Hs.200943

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS191H08 pGCAP10 ACATCCTTTAAATATGGTCTTTCTTGGGCGCGCGCGACAATGTGAGGAGTGGGGTGGAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl