Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06114

HP ID(1) HP06114
Gene ID(2) 440145
Gene Symbol finder C13orf37
Protein Name chromosome 13 open reading frame 37
RefSeq NM_001071775.2
Length of RefSeq (bp) 2412
Chromosome 13q22.1
Reference DDBJ accession
UniGene Hs.28465

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS014J07 pGCAP10 GCCTTCTCCCGCCTCCCTCGGCCTTAGCCATGGCGAGTAGCGGCGGTGCTGGGGCGGCGG
RBdS022B01 pGCAP10 GCCTTCTCCCGCCTCCCTCGGCCTTAGCCATGGCGAGTAGCGGCGGTGCTGGGGCGGCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl