Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06095

HP ID(1) HP06095
Gene ID(2) 387522
Gene Symbol finder TMEM189-UBE2V1
Protein Name TMEM189-UBE2V1 readthrough
RefSeq NM_199203.2
Length of RefSeq (bp) 2925
Chromosome 20q13.2
Reference DDBJ accession
UniGene Hs.727525

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe82C05 pKA1U5 GAAGCAACAGCGACGCAAGATGGCAGCCACCACGGGCTCGGGAGTAAAAGTCCCTCGCAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl