Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06045

HP ID(1) HP06045
Gene ID(2) 5481
Gene Symbol finder PPID
Protein Name peptidylprolyl isomerase D
RefSeq NM_005038.2
Length of RefSeq (bp) 1851
Chromosome 4q31.3
Reference DDBJ accession
UniGene Hs.581725

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb38H07 pGCAP1 TGGGTCAGCGTCGCTGCCGGTCTCCGGCGGAGACGGACTCTGGAGTTTGGGCGGCCCGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl