Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06027

HP ID(1) HP06027
Gene ID(2) 5516
Gene Symbol finder PPP2CB
Protein Name protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform
RefSeq NM_004156.2
Length of RefSeq (bp) 1807
Chromosome 8p12
Reference DDBJ accession
UniGene Hs.491440

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb37C02 pGCAP1 GGAGAGAAAGAGCGAGAGAAGGGGAAAGACAAGTCGGGAGAGGCCGGTAGGCGTGAGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl