Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06017

HP ID(1) HP06017
Gene ID(2) 219833
Gene Symbol finder C11orf45
Protein Name chromosome 11 open reading frame 45
RefSeq NM_145013.1
Length of RefSeq (bp) 3648
Chromosome 11q24.3
Reference DDBJ accession
UniGene Hs.351133

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb35H08 pGCAP1 GAGTGCTTCAAACGCCTTGAGGATAAGGAAGGAGAATCAGCAAGTCCCGAGTTCCTACGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl