Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06004

HP ID(1) HP06004
Gene ID(2) 647087
Gene Symbol finder PL-5283
Protein Name PL-5283 protein
RefSeq NM_001130929.1
Length of RefSeq (bp) 2515
Chromosome 7q33
Reference DDBJ accession
UniGene Hs.200022

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb34E10 pGCAP1 GAAGTCGACGAGGGGTTCCGCCCCCCCCGCGCATGGGGAGGTAGGCTCGGACCGGCCCGC
RBb40H09 pGCAP1 GGTTCCGCCCCCCCCGCGCATGGGGAGGTAGGCTCGGACCGGCCCGCGGAGCTGCTGCAG
RBd11G09 pGCAP10 GAGGCTCGGACCGGCCCGCGGAGCTGCTGCAGTCCTTCGCGCCCTCCTCGCCCTCCCCAC
RBd21G04 pGCAP10 GGGAAGTCGACGAGGGGTTCCGCCCCCCCCGCGCATGGGGAGGTAGGCTCGGACCGGCCC
RBd61F09 pGCAP10 GAGGCTCGGACCGGCCCGCGGAGCTGCTGCAGTCCTTCGCGCCCTCCTCGCCCTCCCCAC
RBd77A10 pGCAP10 GGGACCGGCCCGCGGAGCTGCTGCAGTCCTTCGCGCCCTCCTCGCCCTCCCCACCGACAT
RBdS156D23 pGCAP10 TGGCCCCCCCCGCGCATGGGGAGGTAGGCTCGGACCGGCCCGCGGAGCTGCTGCAGTCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl