Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05993

HP ID(1) HP05993
Gene ID(2) 81572
Gene Symbol finder PDRG1
Protein Name p53 and DNA damage regulated 1
RefSeq NM_030815.2
Length of RefSeq (bp) 1384
Chromosome 20q11.21
Reference DDBJ accession
UniGene Hs.435755

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi42D10 pGCAP10 GGGGAGTCGAAGCGGAGATCCCGGGGTCGCGCGAGAGCCGCAAGCGGAGTTGGTGGGCGC
ARi62H04 pGCAP10 GGAGTTGGTGGGCGCTATGCTATCACCCGAGGCAGAGCGAGTGCTGCGGTACCTTGTAGA
RBb33B03 pGCAP1 GAGCCGCAAGCGGAGTTGGTGGGCGCTATGCTATCACCCGCAGGCAGAGCGAGTGCTGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl