Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05986

HP ID(1) HP05986
Gene ID(2) 28970
Gene Symbol finder C11orf54
Protein Name chromosome 11 open reading frame 54
RefSeq NM_014039.2
Length of RefSeq (bp) 2403
Chromosome 11q21
Reference DDBJ accession
UniGene Hs.8360

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi10A03 pGCAP10 GGTTGGCCTAGGCGAAGATCCGGACTCTGGGTGTTTTGCTACCGTGACCGTTTAGAACAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl