Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05955

HP ID(1) HP05955
Gene ID(2) 55759
Gene Symbol finder WDR12
Protein Name WD repeat domain 12
RefSeq NM_018256.2
Length of RefSeq (bp) 1720
Chromosome 2q33.1
Reference DDBJ accession
UniGene Hs.73291

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS198C14 pGCAP10
RBd14H07 pGCAP10 GGCAGAGGAGACCGGAGGGCAGAAGGCAGAGTCCAGGCTTAGACTGCAGTTCCTCGCTTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl