Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05890

HP ID(1) HP05890
Gene ID(2) 9774
Gene Symbol finder BCLAF1
Protein Name BCL2-associated transcription factor 1
RefSeq NM_014739.2
Length of RefSeq (bp) 7277
Chromosome 6q22-q23
Reference DDBJ accession
UniGene Hs.486542

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe78D10 pKA1U5 GGGAAGTGACGGAGACGTGCTAGCGCGTCGAAGGTAGCTCTATGGTTTTCCTCGCGTTCT
RBd81F03 pGCAP10 GAGTCGGGAAATGGCCGCTGTGTGGTTGCAACGGAGATAAATTCCCGGAACCGCGATTCG
RBd97F04 pGCAP10 GAGCTCTATGGTTTTCCTCGCGTTCTTGAGTCGGGAAATGGCCGCTGTGTGGTTGCAACG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl