Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05856

HP ID(1) HP05856
Gene ID(2) 26151
Gene Symbol finder NAT9
Protein Name N-acetyltransferase 9
RefSeq NM_015654.3
Length of RefSeq (bp) 1943
Chromosome 17q25.1
Reference DDBJ accession
UniGene Hs.144058

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb27E09 pGCAP1 GGCCGGGCCTGGGAACGTGGCTGGTTGGAGGAGGTAGATCACCCTTTTCTGCGGGGGACG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl