Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05846

HP ID(1) HP05846
Gene ID(2) 23594
Gene Symbol finder ORC6L
Protein Name origin recognition complex, subunit 6 like (yeast)
RefSeq NM_014321.2
Length of RefSeq (bp) 1647
Chromosome 16q12
Reference DDBJ accession
UniGene Hs.49760

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi50D04 pGCAP10 GGCGCGCGGGTTTCGTTGACCCGCGGCGTTCACGGGAATTGCTCGCTTTAGTGCCGGCGC
RBb25H01 pGCAP1 TTGGGGTTTCGTTGACCCGCGGCGTTCACGGGAATTGTTCGCTTTAGTGCCGGCGCCATG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl