Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05839

HP ID(1) HP05839
Gene ID(2) 3833
Gene Symbol finder KIFC1
Protein Name kinesin family member C1
RefSeq NM_002263.3
Length of RefSeq (bp) 2721
Chromosome 6p21.3
Reference DDBJ accession
UniGene Hs.436912

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb25A10 pGCAP1 GACCCTGCTTCGCGAGCGGGCGAGAGAACGCGAGTCCCAGGATCCCCGGCACCCAGTTCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl