Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05832

HP ID(1) HP05832
Gene ID(2) 54929
Gene Symbol finder TMEM161A
Protein Name transmembrane protein 161A
RefSeq NM_017814.1
Length of RefSeq (bp) 1795
Chromosome 19p13.11
Reference DDBJ accession
UniGene Hs.631629

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb24C03 pGCAP1 TGGCCCGGAGCCCTAGGCCGGTGGGTGAGTGCACCGCGTTCTCGCACGCGTCATGGGGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl