Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05777

HP ID(1) HP05777
Gene ID(2) 23483
Gene Symbol finder TGDS
Protein Name TDP-glucose 4,6-dehydratase
RefSeq NM_014305.2
Length of RefSeq (bp) 1952
Chromosome 13q32.1
Reference DDBJ accession
UniGene Hs.12393

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS013M24 pGCAP10 GAGCTGCCTCTGGCTGCTCTGTTAACGTGTCCCGCGAGCGAGGCGCGTCGCAAAAGGTCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl