Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05774

HP ID(1) HP05774
Gene ID(2) 91304
Gene Symbol finder C19orf6
Protein Name chromosome 19 open reading frame 6
RefSeq NM_033420.3
Length of RefSeq (bp) 2654
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.515003

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe74B12 pKA1U5 GGGACGAGAAAGCGGAAGATGGCGGCGGCGGCCGGGAGGCCGTGAGGAGAGCGGCGGCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl