Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05768

HP ID(1) HP05768
Gene ID(2) 26519
Gene Symbol finder TIMM10
Protein Name translocase of inner mitochondrial membrane 10 homolog (yeast)
RefSeq NM_012456.2
Length of RefSeq (bp) 684
Chromosome 11q12.1-q12.3
Reference DDBJ accession
UniGene Hs.235750

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS110E20 pGCAP10 GGGAAGTAACCCACGTGCTTCCGCTGGAGCCTCTCGGGAGGCGGGTAACGTTATAGTATT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl