Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05763

HP ID(1) HP05763
Gene ID(2) 84231
Gene Symbol finder TRAF7
Protein Name TNF receptor-associated factor 7
RefSeq NM_032271.2
Length of RefSeq (bp) 3676
Chromosome 16p13.3
Reference DDBJ accession
UniGene Hs.713632

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS013P12 pGCAP10 GAGTCCCTTTCCCGGCCGGCGGCCGAGGGGGCATCATGAAGCGGGCTGGCGGCGCTGCCG
RBd40H03 pGCAP10 GGTCTAGTCCCTTTCCCGGCCGGCGGCCGAGGGGGCATCATGAAGCGGGCTGGCGGCGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl