Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05749

HP ID(1) HP05749
Gene ID(2) 79095
Gene Symbol finder C9orf16
Protein Name chromosome 9 open reading frame 16
RefSeq NM_024112.3
Length of RefSeq (bp) 723
Chromosome 9q34.1
Reference DDBJ accession
UniGene Hs.522412

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARh05E09 pGCAP1 ACCTTCCATCCGGCGCCGGCTTTCGGCGCGACGGTCGCCGCGTTCCATCGTCGC
RBd34B10 pGCAP10 GATCCGGCGCCGGCTTTCGGCGCGACGGTCGCCGCGTTCCATCGTCGCGCGGCCCTTCGG
RBd51G06 pGCAP10 GGGCGCCGGCTTTCGGCGCGACGGTCGCCGCGTTCCATCGTCGCGCGGCCCTTCGGGCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl