Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05747

HP ID(1) HP05747
Gene ID(2) 10180
Gene Symbol finder RBM6
Protein Name RNA binding motif protein 6
RefSeq NM_005777.1
Length of RefSeq (bp) 3639
Chromosome 3p21.3
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb47B08 pGCAP1 AATGTGATCTCCCAGCGGGCCGAGCGCTGAAGGCAGCGGCGCGGCGCCTTTGTGGTAGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl