Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05740

HP ID(1) HP05740
Gene ID(2) 55746
Gene Symbol finder NUP133
Protein Name nucleoporin 133kDa
RefSeq NM_018230.2
Length of RefSeq (bp) 4170
Chromosome 1q42.13
Reference DDBJ accession
UniGene Hs.12457

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb24B11 pGCAP1 GGCGCGCAGGCCAGGCTGCAACCTGACGGCCAGATCCCTCGCTGTCCTAGTCGCTGCTCC
RBdS040H20 pGCAP10 GGTTTNNGTTCCGCGCGCAGGCCAGGCTGCAACCTGACGGCCAGATCCCTCGCTGTCCTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl