Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05732

HP ID(1) HP05732
Gene ID(2) 85014
Gene Symbol finder TMEM141
Protein Name transmembrane protein 141
RefSeq NM_032928.3
Length of RefSeq (bp) 875
Chromosome 9q34.3
Reference DDBJ accession
UniGene Hs.356744

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS022A22 pGCAP10 GGCCCTTCCGCCTGCGCCTGCGCAGGCCCGCTCCCCGAGCCCTGCCAACCATGGTGAACT
RBdS070B10 pGCAP10 GGCCTGCGCAGGCCCGCTCCCCGAGCCCTGCCAACCATGGTGAACTTGGGTCTGTCCCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl