Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05719

HP ID(1) HP05719
Gene ID(2) 55920
Gene Symbol finder RCC2
Protein Name regulator of chromosome condensation 2
RefSeq NM_018715.1
Length of RefSeq (bp) 4114
Chromosome 1p36.13
Reference DDBJ accession
UniGene Hs.380857

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe97E08 pKA1U5 GGTTCTGGAAGCTCGTATTTACATTTTAAGTGTATCTGGTGAGTGGGCTGGAGCCCTCGT
RBdS110O01 pGCAP10 GACATTTTANNTGTNTCTGGTGAGTGGGCTGGAGCCCTCGTCTGGGCCGGAAAAAAAAAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl