Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05655

HP ID(1) HP05655
Gene ID(2) 5170
Gene Symbol finder PDPK1
Protein Name 3-phosphoinositide dependent protein kinase-1
RefSeq NM_002613.3
Length of RefSeq (bp) 7254
Chromosome 16p13.3
Reference DDBJ accession
UniGene Hs.459691

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe66G11 pKA1U5 GGAGGGCGGCCATTGCTGGGGCTCCGCTTCGGGGAGGAGGACGCTGAGGAGGCGCCGAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl