Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05650

HP ID(1) HP05650
Gene ID(2) 91624
Gene Symbol finder NEXN
Protein Name nexilin (F actin binding protein)
RefSeq NM_144573.3
Length of RefSeq (bp) 3405
Chromosome 1p31.1
Reference DDBJ accession
UniGene Hs.632387

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe66B09 pKA1U5 GGCTGGAGACGGCGGCGGCGGCGGCGGCAGCGNCANCCAGAGGACTCCCAGCGGCTGGAG
ARi18A02 pGCAP10 GGCTGGGCCCGCCTGGAATGCGGGAACAGGCTGCACACCAGGACTTTTATGGAAACTTGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl