Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05632

HP ID(1) HP05632
Gene ID(2) 9488
Gene Symbol finder PIGB
Protein Name phosphatidylinositol glycan anchor biosynthesis, class B
RefSeq NM_004855.4
Length of RefSeq (bp) 2227
Chromosome 15q21-q22
Reference DDBJ accession
UniGene Hs.612814

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe63G04 pKA1U5 GCTTCCGCCTTAGGAAGGTGGCGGCCAGGGATGAGGAGGCCCCTAAGCAAGTGCGGAATG
ARi05H04 pGCAP10 GCTTCCGCCTTAGGAAGGTGGCGGCCAGGGATGAGGAGGCCCCTAAGCAAGTGCGGAATG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl