Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05584

HP ID(1) HP05584
Gene ID(2) 9414
Gene Symbol finder TJP2
Protein Name tight junction protein 2 (zona occludens 2)
RefSeq NM_004817.2
Length of RefSeq (bp) 4618
Chromosome 9q13-q21
Reference DDBJ accession
UniGene Hs.50382

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe57H08 pKA1U5 GGACAGCCGCCGCCCACCCCCTTCCCCTCCCCCCCTTTNGACTCTCTGGCTCGCCACCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl