Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05579

HP ID(1) HP05579
Gene ID(2) 9943
Gene Symbol finder OXSR1
Protein Name oxidative-stress responsive 1
RefSeq NM_005109.2
Length of RefSeq (bp) 4525
Chromosome 3p22-p21.3
Reference DDBJ accession
UniGene Hs.475970

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe57F12 pKA1U5 GGGAGGGCGGGACAGAGGGGCTGGGCCCAGGCAAAGCTTCTGTCGCTGCTGCTGCGGAGG
ARe77A01 pKA1U5 GGCCCTTTGGTCGCCATGCTTAGTGTGGCTACCGCCTCTGTGCTACTTGAGGCTCTCCTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl