Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05539

HP ID(1) HP05539
Gene ID(2) 57590
Gene Symbol finder WDFY1
Protein Name WD repeat and FYVE domain containing 1
RefSeq NM_020830.3
Length of RefSeq (bp) 4607
Chromosome 2q36.1
Reference DDBJ accession
UniGene Hs.708107

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe53C05 pKA1U5 GGTCAGCTGATGGGCTGCCTGCCGAGGAGGCCGCAGCAGTCGCCGCGCGAACATGGCGGC
ARe61D07 pKA1U5 GGTCAGCTGATGGGCTGCCTGCCGAGGAGGCCCCATNAGATCGCCGCGCGAACATGGCGG
ARe78B09 pKA1U5 GGCGCGAACATGGCGGCCGAAATCCACTCCAGGCCGCAGAGCAGCCGCCCGGTGCTGCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl