Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05517

HP ID(1) HP05517
Gene ID(2) 55624
Gene Symbol finder POMGNT1
Protein Name protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase
RefSeq NM_017739.2
Length of RefSeq (bp) 2753
Chromosome 1p34.1
Reference DDBJ accession
UniGene Hs.525134

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb17D03 pKA1U5 GAGGCCGGGGCGGGGCCGCAAGCGGCATGGAGGAGGCGGAGGCCGCGGCGAGCCGGGCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl