Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05514

HP ID(1) HP05514
Gene ID(2) 89953
Gene Symbol finder KLC4
Protein Name kinesin light chain 4
RefSeq NM_138343.2
Length of RefSeq (bp) 1284
Chromosome 6p21.1
Reference DDBJ accession
UniGene Hs.655123

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb16H09 pKA1U5 GAGCCACACCGGCAGATTGCAGACCGGGCAAGGTCCCCCAGGCCAGGATGTCAGGCCTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl