Prev. | NRCD Clone Y | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05444

HP ID(1) HP05444
Gene ID(2) 10652
Gene Symbol finder YKT6
Protein Name YKT6 v-SNARE homolog (S. cerevisiae)
RefSeq NM_006555.3
Length of RefSeq (bp) 2783
Chromosome 7p15.1
Reference DDBJ accession
UniGene Hs.520794

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe44C08 pKA1U5 GGGCGGCGGTTCCCGAGGGGCGGCGGCCGCGCTGCTCCCTGAGAACGGGTCCCGCAGCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl