Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05414

HP ID(1) HP05414
Gene ID(2) 22980
Gene Symbol finder TCF25
Protein Name transcription factor 25 (basic helix-loop-helix)
RefSeq NM_014972.1
Length of RefSeq (bp) 2267
Chromosome 16q24.3
Reference DDBJ accession
UniGene Hs.415342

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe40G05 pKA1U5 ATCCTGGGTTTTCTGCGCTTCCTTCTCCCTCTCTCCAGACGTCGTGGTCGTTCGGTCCTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl