Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05412

HP ID(1) HP05412
Gene ID(2) 23022
Gene Symbol finder PALLD
Protein Name palladin, cytoskeletal associated protein
RefSeq NM_016081.3
Length of RefSeq (bp) 5809
Chromosome 4q32.3
Reference DDBJ accession
UniGene Hs.151220

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe40E07 pKA1U5 GACACTCCGCGCACACGCGCCCCTCGGCGAGACGCGNNGCATTCGCGCGCTGGAGACCGG
ARiS096B22 pGCAP10 GGCGGAGCCCGCTGCAGCTCCCGCTCGCTCCGGACGCGGAATCGGGCAGCAGCGGGAGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl