Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05396

HP ID(1) HP05396
Gene ID(2) 4998
Gene Symbol finder ORC1L
Protein Name origin recognition complex, subunit 1-like (yeast)
RefSeq NM_004153.2
Length of RefSeq (bp) 3180
Chromosome 1p32
Reference DDBJ accession
UniGene Hs.17908

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb21E04 pKA1U5 TATTGGGCGCGAAGTTTTCTTTTCTCCTTCCACCNTCTTTTCATTTCTAGTGAGACACAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl