Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05382

HP ID(1) HP05382
Gene ID(2) 9050
Gene Symbol finder PSTPIP2
Protein Name proline-serine-threonine phosphatase interacting protein 2
RefSeq NM_024430.3
Length of RefSeq (bp) 3054
Chromosome 18q12
Reference DDBJ accession
UniGene Hs.567384

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb20A12 pKA1U5 GGCGGCTTCCCTGCGCGAGTGTGGAACGCAGAAGTTGAGTCTGCGGAGCCGCGGGCAGTG
RBdS110K08 pGCAP10 GAGAAGTTGAGTCTGCGGAGCCGCGGGCAGTGGCAGTCAGGCCTCCCCGCTCTGTGCTAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl