Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05374

HP ID(1) HP05374
Gene ID(2) 57691
Gene Symbol finder KIAA1586
Protein Name KIAA1586
RefSeq NM_020931.1
Length of RefSeq (bp) 2878
Chromosome 6p12.1
Reference DDBJ accession
UniGene Hs.709521

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb19B01 pKA1U5 GGGCGGCTGCGGCAGTAGGGACAGCAGGAGCAGTGGTGCTGTCAGCGCGGCCGTCGGAGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl