Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05363

HP ID(1) HP05363
Gene ID(2) 54971
Gene Symbol finder BANP
Protein Name BTG3 associated nuclear protein
RefSeq NM_017869.3
Length of RefSeq (bp) 2230
Chromosome 16q24.2-q24.3
Reference DDBJ accession
UniGene Hs.461705

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb15H06 pKA1U5 GGCAGAGCGGCGGCTTCTCTCGCGAGGACGGACGCCTTTATCGCATCTCCCCGACAAACA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl