Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05255

HP ID(1) HP05255
Gene ID(2) 221908
Gene Symbol finder C7orf47
Protein Name chromosome 7 open reading frame 47
RefSeq NM_145030.2
Length of RefSeq (bp) 960
Chromosome 7q22.1
Reference DDBJ accession
UniGene Hs.413359

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb07D05 pKA1U5 GAGCGGCGCTCTAGGAGGGGCGGGGGAAAGGAGGCGGCAGCCAGGCTGTGTCCCCTGACC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl