Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05254

HP ID(1) HP05254
Gene ID(2) 54995
Gene Symbol finder OXSM
Protein Name 3-oxoacyl-ACP synthase, mitochondrial
RefSeq NM_017897.1
Length of RefSeq (bp) 1544
Chromosome 3p24.2
Reference DDBJ accession
UniGene Hs.55781

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb07D03 pKA1U5 ATCCTGGGCCCCCGACTGTGGAGAAGTGTCCGGGGTAGCCCCGTTACAGGTATCGCTGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl