Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05183

HP ID(1) HP05183
Gene ID(2) 23244
Gene Symbol finder PDS5A
Protein Name PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)
RefSeq NM_001100399.1
Length of RefSeq (bp) 7190
Chromosome 4p14
Reference DDBJ accession
UniGene Hs.331431

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS096K04 pGCAP10 GTGACCGGCCNTTGTGTGCNCTANGCCCCGGCTCCCGGGGCACGGACGGCCGGGCGCGCG
RBb02C04 pKA1U5 AB621803 GGGAGGCGGATGCACGGCCGGCGGAGGAAGGGGAGGGAGCGAGGAGCGCGCGCTGCTCTC
RBd32E06 pGCAP10 GGGAAGTTTAGGGAGCGAGGAGCGCGCGCTGCTCTCGCGTGCTCTCGCGCCGCTCGCGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl