Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05158

HP ID(1) HP05158
Gene ID(2) 60490
Gene Symbol finder PPCDC
Protein Name phosphopantothenoylcysteine decarboxylase
RefSeq NM_021823.3
Length of RefSeq (bp) 2268
Chromosome 15q24.2
Reference DDBJ accession
UniGene Hs.458922

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe39C04 pKA1U5 GGAGACGCGCCTGGCGCGGCTGGAAGTAGCAGTGGTCACAACTGAGAGAGCCAAACATTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl