Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05154

HP ID(1) HP05154
Gene ID(2) 79912
Gene Symbol finder PYROXD1
Protein Name pyridine nucleotide-disulphide oxidoreductase domain 1
RefSeq NM_024854.3
Length of RefSeq (bp) 4136
Chromosome 12p12.1
Reference DDBJ accession
UniGene Hs.709545

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe39A09 pKA1U5 GGCGCGGCTGCTTCCTCTCCTGGAGTCCAGAGTCCCGCTGCTCCGCCGCGATATTCAGTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl